Case Report
Rev Diabet Stud,
2006,
3(4):205-207 |
DOI 10.1900/RDS.2006.3.205 |
Maternally Inherited Diabetes with Deafness and Obesity: Body Weight Reduction Response to Treatment with Insulin Analogues
Maciej T. Malecki1, Jan Skupien1, Tomasz Klupa1, Antonina Naskalska1, Sylwia Gorczynska-Kosiorz2, Dariusz K. Moczulski2, Jacek Sieradzki1
1Department of Metabolic Diseases, Jagiellonian University, Medical College, Krakow, Poland.
2Department of Internal Medicine, Diabetology and Nephrology, Silesian School of Medicine, Zabrze, Poland.
Address correspondence to: Maciej T. Malecki, e-mail: mmalecki@cm-uj.krakow.pl
Keywords: MIDD, diabetes, mitochondrial genome, obesity, insulin analogues
Abstract
Maternally inherited diabetes with deafness (MIDD) is a rare, monogenic form of diabetes mellitus caused by mutations in the mitochondrial genome, the most frequent being the A3243G substitution of the tRNALeu gene. We screened 520 individuals with type 2 diabetes mellitus and 45 probands from families with a clinical picture of maturity onset diabetes of the young (MODY) using restriction fragment length polymorphism. One carrier of the mutation being investigated was found in a proband from a MODY family. The patient was a 20 year-old woman, diagnosed at the age of 16 years as having type 1 diabetes mellitus. On entry to the study, she was treated by a multiple daily injection regimen (MDI) with regular human insulin and human NPH insulin. Typical extra-pancreatic symptoms of MIDD were present, such as macular pattern dystrophy and mild bilateral sensory hearing loss. Additionally, the patient presented abdominal obesity (BMI 32.0), an uncommon feature in monogenic insulin secretion defects, including MIDD. To facilitate weight loss, the diabetes treatment was modified. Since metformin treatment is considered to be contraindicated in MIDD because of the increased risk of lactic acidosis, we used insulin analogues (aspart and detemir) in an MDI regimen and hypocaloric diet. This resulted in a 6.3 kg weight reduction (BMI 27.4) and normalization of HbA1c level (from 7.2 to 6.1 %) during a three-month follow-up. On the basis of this case, we suggest that an MDI regimen with insulin analogues may be a preferred therapeutic option in some rare clinical situations, such as MIDD associated with obesity.
Case report
Maternally inherited diabetes with deafness (MIDD) is a rare, monogenic form of the disease caused by mutations in the mitochondrial genome, most frequently the A3243G tRNALeu substitution [1, 2]. Impaired pancreatic β-cell insulin secretion is its major pathophysiological mechanism. MIDD is characterized by variability in clinical presentation, as it may mimic type 1 as well as type 2 diabetes [2]. The disease is usually diagnosed in early adulthood; however the range of age of onset is wide.
We screened for the A3243G tRNALeu substitution in 520 unrelated individuals with a clinical diagnosis of type 2 diabetes and 45 probands of maturity onset diabetes from young (MODY) families using restriction fragment length polymorphism. We used the following primer pair: forward - 5' AAGGTTCGTTTGTTCAACGA 3', reverse - 5' AGCGAAGGGTTGTAGTAGCC3' and Bsp120I restriction endonuclease (Fermentas). All subjects were Caucasian residents of Poland. This study was performed according to the Helsinki Declaration with the approval of the Ethics Committee of the Jagiellonian University Medical College. All of the individuals included in this study gave informed consent prior to inclusion.
We identified just one mutation carrier, a 20-year-old woman who was a proband from a family from the MODY registry, diagnosed at the age of 16 years. She was also diagnosed with early stage hypoacusis, macular pattern dystrophy, hypertension, and mild depression. The only family member available for the study was her 50 year-old mother, who had been diagnosed at the age of 35 and treated with insulin since diagnosis. We confirmed the presence of the A3243G point mutation in the proband’s mother. The family pedigree is shown in Figure 1. The detailed clinical characteristics of the patients are presented in Table 1.
 |
 |
Figure 1. The MIDD family pedigree. Closed and open symbols represent subjects with diabetes and normal glucose tolerance respectively. The numbers indicate patient's ID according to the Polish Registry of MODY Families, age at examination / age at diagnosis of diabetes and genotype at the 3243 position in the mitochondrial genome. The arrow indicates the proband. |
|
Table
1.
Clinical characteristics of the MIDD patients |
|
 |
 |
Legend:
BMI: body mass index. WHR: waist-to-hip ratio. |
|
Interestingly, the proband was characterized by abdominal obesity, an uncommon condition in MIDD. Her body mass index was 32.0. In spite of long-term suggestions to reduce her obesity and repeated dietary advice, she was unable to reduce her weight. At the initial examination, she was treated by a multiple daily injection (MDI) regimen based on regular human insulin and neutral protamine Hagedorn insulin as basal insulin. She received 1 U of insulin/kg daily and her HbA1c was 7.2%. In addition, ultrasonography revealed asymptomatic gallstones. The surgeon suggested weight reduction before cholecystectomy.
Weight reduction is a challenge for diabetic patients on insulin. Moreover, metformin is considered to be contraindicated in MIDD patients because of the potential risk of lactate acidosis [2]. Initially, this woman’s lactate level was 2.2 mmol/l, slightly above the upper limit of the reference range (2.1 mmol/l). Multiple injections of aspart, a short-acting insulin analog, were administered together with one evening injection of detemir, a long-acting insulin analog. The woman was also instructed to maintain a diet of 1200 kcal, the regimen previously recommended. At 3-month follow-up her weight had decreased by 6.3 kg and the daily insulin dose had fallen by 30 U. These changes were accompanied by a decrease in HbA1c level to 6.1%, while lactate level remained stable. Having achieved substantial weight reduction, she underwent successful cholecystectomy.
Nowadays, identification of the molecular background of specific forms of diabetes supplies new insight into their underlying etiology. This should help to optimize treatment in specific clinical situations, which is an essential aspect of pharmacogenetics, including avoidance of medications that might be harmful in particular forms of diabetes. Metformin is not recommended for safety reasons in MIDD associated with obesity, so we used an MDI regimen based on insulin analogues. This algorithm showed a favorable impact on body weight, as compared to traditional insulins, in patients with both type 1 and type 2 diabetes [3, 4]. On the basis of this case, we suggest that this regimen, together with appropriate dietary advice, should be a preferred therapeutic option in certain other rare clinical situations, such as MIDD associated with obesity.
Acknowledgments:
This research was supported by the State Committee for Scientific Research Grant 2 P05B 070 28 and funds from the Medical College, Jagiellonian University (Grant 501/NKL/59/L).
References
- Kadowaki T, Kadowaki H, Mori Y, Tobe K, Sakuta R, Suzuki Y, Tanabe Y, Sakura H, Awata T, Goto Y. A subtype of diabetes mellitus associated with a mutation of mitochondrial DNA. N Engl J Med 1994. 330:962-968. [DOD] [CrossRef]
- Maassen JA, 'T Hart LM, Van Essen E, Heine RJ, Nijpels G, Jahangir Tafrechi RS, Raap AK, Janssen GM, Lemkes HH. Mitochondrial diabetes: molecular mechanisms and clinical presentation. Diabetes 2004. 53(Suppl 1):S103-S109. [DOD]
- Hermansen K, Fontaine P, Kukolja KK, Peterkova V, Leth G, Gall MA. Insulin analogues (insulin detemir and insulin aspart) versus traditional human insulins (NPH insulin and regular human insulin) in basal-bolus therapy for patients with type 1 diabetes. Diabetologia 2004. 47:622-629. [DOD] [CrossRef]
- Raslova K, Bogoev M, Raz I, Leth G, Gall MA, Hancu N. Insulin detemir and insulin aspart: a promising basal-bolus regimen for type 2 diabetes. Diabetes Res Clin Pract 2004. 66:193-201. [DOD] [CrossRef]
This article has been cited by other articles:
|
Can geneticists help clinicians to understand and treat non-autoimmune diabetes?
Malecki MT, Mlynarski W, Skupien J
Diabetes Res Clin Pract 2008. 82(Suppl 2):S83-S93
|
|
|
Monogenic diabetes: implications for therapy of rare types of disease
Malecki MT, Mlynarski W
Diabetes Obes Metab 2008. 10(8):607-616
|
|
|
Problems in differential diagnosis of diabetes types
Malecki M, Skupien J
Pol Arch Med Wewn 2008. 118(7-8):435-440
|
|
|
Islet specific antibodies seroconversion in patients with long duration of permanent neonatal diabetes caused by mutations in the KCNJ11 gene
Gach A, Wyka K, Malecki MT, Noczynska A, Skupien J, Nazim J, Szalecki M, Bodalski J, Sieradzki J, Mlynarski W
Diabetes Care 2007. 30(8):2080-2082
|
|
|